ID: 938208332

View in Genome Browser
Species Human (GRCh38)
Location 2:129442670-129442692
Sequence GTTTCTATGGGGATCATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938208332_938208339 -3 Left 938208332 2:129442670-129442692 CCCTCCATGATCCCCATAGAAAC No data
Right 938208339 2:129442690-129442712 AACCCCAGGCAAAAGTTCCTTGG No data
938208332_938208345 13 Left 938208332 2:129442670-129442692 CCCTCCATGATCCCCATAGAAAC No data
Right 938208345 2:129442706-129442728 TCCTTGGGTAGAGGAATTTGAGG No data
938208332_938208340 -2 Left 938208332 2:129442670-129442692 CCCTCCATGATCCCCATAGAAAC No data
Right 938208340 2:129442691-129442713 ACCCCAGGCAAAAGTTCCTTGGG No data
938208332_938208344 4 Left 938208332 2:129442670-129442692 CCCTCCATGATCCCCATAGAAAC No data
Right 938208344 2:129442697-129442719 GGCAAAAGTTCCTTGGGTAGAGG No data
938208332_938208347 14 Left 938208332 2:129442670-129442692 CCCTCCATGATCCCCATAGAAAC No data
Right 938208347 2:129442707-129442729 CCTTGGGTAGAGGAATTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938208332 Original CRISPR GTTTCTATGGGGATCATGGA GGG (reversed) Intergenic
No off target data available for this crispr