ID: 938210222

View in Genome Browser
Species Human (GRCh38)
Location 2:129460728-129460750
Sequence CAGGCTATGGAGAAGGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938210214_938210222 -7 Left 938210214 2:129460712-129460734 CCCACTCCCACTGGCACAGGCTA No data
Right 938210222 2:129460728-129460750 CAGGCTATGGAGAAGGGGACAGG No data
938210211_938210222 -1 Left 938210211 2:129460706-129460728 CCCACTCCCACTCCCACTGGCAC No data
Right 938210222 2:129460728-129460750 CAGGCTATGGAGAAGGGGACAGG No data
938210210_938210222 0 Left 938210210 2:129460705-129460727 CCCCACTCCCACTCCCACTGGCA No data
Right 938210222 2:129460728-129460750 CAGGCTATGGAGAAGGGGACAGG No data
938210208_938210222 12 Left 938210208 2:129460693-129460715 CCTTGCTTATGTCCCCACTCCCA No data
Right 938210222 2:129460728-129460750 CAGGCTATGGAGAAGGGGACAGG No data
938210215_938210222 -8 Left 938210215 2:129460713-129460735 CCACTCCCACTGGCACAGGCTAT No data
Right 938210222 2:129460728-129460750 CAGGCTATGGAGAAGGGGACAGG No data
938210212_938210222 -2 Left 938210212 2:129460707-129460729 CCACTCCCACTCCCACTGGCACA No data
Right 938210222 2:129460728-129460750 CAGGCTATGGAGAAGGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938210222 Original CRISPR CAGGCTATGGAGAAGGGGAC AGG Intergenic
No off target data available for this crispr