ID: 938212881

View in Genome Browser
Species Human (GRCh38)
Location 2:129483376-129483398
Sequence GATGAAGGAGTTGCCCCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938212876_938212881 23 Left 938212876 2:129483330-129483352 CCTCTATGAAGACTCTCGGCATT No data
Right 938212881 2:129483376-129483398 GATGAAGGAGTTGCCCCTCAAGG No data
938212877_938212881 -6 Left 938212877 2:129483359-129483381 CCAGATCACATCTCCCAGATGAA No data
Right 938212881 2:129483376-129483398 GATGAAGGAGTTGCCCCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938212881 Original CRISPR GATGAAGGAGTTGCCCCTCA AGG Intergenic
No off target data available for this crispr