ID: 938214457

View in Genome Browser
Species Human (GRCh38)
Location 2:129499161-129499183
Sequence TGAGGTGGAAGTAGTGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938214457_938214461 -9 Left 938214457 2:129499161-129499183 CCCCTCTCACTACTTCCACCTCA No data
Right 938214461 2:129499175-129499197 TCCACCTCACACTGTACTGGAGG No data
938214457_938214466 2 Left 938214457 2:129499161-129499183 CCCCTCTCACTACTTCCACCTCA No data
Right 938214466 2:129499186-129499208 CTGTACTGGAGGGCTAACCAGGG No data
938214457_938214465 1 Left 938214457 2:129499161-129499183 CCCCTCTCACTACTTCCACCTCA No data
Right 938214465 2:129499185-129499207 ACTGTACTGGAGGGCTAACCAGG No data
938214457_938214463 -8 Left 938214457 2:129499161-129499183 CCCCTCTCACTACTTCCACCTCA No data
Right 938214463 2:129499176-129499198 CCACCTCACACTGTACTGGAGGG No data
938214457_938214470 25 Left 938214457 2:129499161-129499183 CCCCTCTCACTACTTCCACCTCA No data
Right 938214470 2:129499209-129499231 CAATTGGGAAAGAAAATCGTAGG No data
938214457_938214467 9 Left 938214457 2:129499161-129499183 CCCCTCTCACTACTTCCACCTCA No data
Right 938214467 2:129499193-129499215 GGAGGGCTAACCAGGGCAATTGG No data
938214457_938214468 10 Left 938214457 2:129499161-129499183 CCCCTCTCACTACTTCCACCTCA No data
Right 938214468 2:129499194-129499216 GAGGGCTAACCAGGGCAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938214457 Original CRISPR TGAGGTGGAAGTAGTGAGAG GGG (reversed) Intergenic
No off target data available for this crispr