ID: 938214461

View in Genome Browser
Species Human (GRCh38)
Location 2:129499175-129499197
Sequence TCCACCTCACACTGTACTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938214455_938214461 25 Left 938214455 2:129499127-129499149 CCTAAATCTAAAAATGGCAACAA No data
Right 938214461 2:129499175-129499197 TCCACCTCACACTGTACTGGAGG No data
938214457_938214461 -9 Left 938214457 2:129499161-129499183 CCCCTCTCACTACTTCCACCTCA No data
Right 938214461 2:129499175-129499197 TCCACCTCACACTGTACTGGAGG No data
938214458_938214461 -10 Left 938214458 2:129499162-129499184 CCCTCTCACTACTTCCACCTCAC No data
Right 938214461 2:129499175-129499197 TCCACCTCACACTGTACTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938214461 Original CRISPR TCCACCTCACACTGTACTGG AGG Intergenic
No off target data available for this crispr