ID: 938214463

View in Genome Browser
Species Human (GRCh38)
Location 2:129499176-129499198
Sequence CCACCTCACACTGTACTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938214459_938214463 -10 Left 938214459 2:129499163-129499185 CCTCTCACTACTTCCACCTCACA No data
Right 938214463 2:129499176-129499198 CCACCTCACACTGTACTGGAGGG No data
938214458_938214463 -9 Left 938214458 2:129499162-129499184 CCCTCTCACTACTTCCACCTCAC No data
Right 938214463 2:129499176-129499198 CCACCTCACACTGTACTGGAGGG No data
938214455_938214463 26 Left 938214455 2:129499127-129499149 CCTAAATCTAAAAATGGCAACAA No data
Right 938214463 2:129499176-129499198 CCACCTCACACTGTACTGGAGGG No data
938214457_938214463 -8 Left 938214457 2:129499161-129499183 CCCCTCTCACTACTTCCACCTCA No data
Right 938214463 2:129499176-129499198 CCACCTCACACTGTACTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938214463 Original CRISPR CCACCTCACACTGTACTGGA GGG Intergenic
No off target data available for this crispr