ID: 938214464

View in Genome Browser
Species Human (GRCh38)
Location 2:129499179-129499201
Sequence TAGCCCTCCAGTACAGTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938214464_938214470 7 Left 938214464 2:129499179-129499201 CCTCACACTGTACTGGAGGGCTA No data
Right 938214470 2:129499209-129499231 CAATTGGGAAAGAAAATCGTAGG No data
938214464_938214467 -9 Left 938214464 2:129499179-129499201 CCTCACACTGTACTGGAGGGCTA No data
Right 938214467 2:129499193-129499215 GGAGGGCTAACCAGGGCAATTGG No data
938214464_938214468 -8 Left 938214464 2:129499179-129499201 CCTCACACTGTACTGGAGGGCTA No data
Right 938214468 2:129499194-129499216 GAGGGCTAACCAGGGCAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938214464 Original CRISPR TAGCCCTCCAGTACAGTGTG AGG (reversed) Intergenic
No off target data available for this crispr