ID: 938214465

View in Genome Browser
Species Human (GRCh38)
Location 2:129499185-129499207
Sequence ACTGTACTGGAGGGCTAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938214457_938214465 1 Left 938214457 2:129499161-129499183 CCCCTCTCACTACTTCCACCTCA No data
Right 938214465 2:129499185-129499207 ACTGTACTGGAGGGCTAACCAGG No data
938214458_938214465 0 Left 938214458 2:129499162-129499184 CCCTCTCACTACTTCCACCTCAC No data
Right 938214465 2:129499185-129499207 ACTGTACTGGAGGGCTAACCAGG No data
938214459_938214465 -1 Left 938214459 2:129499163-129499185 CCTCTCACTACTTCCACCTCACA No data
Right 938214465 2:129499185-129499207 ACTGTACTGGAGGGCTAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938214465 Original CRISPR ACTGTACTGGAGGGCTAACC AGG Intergenic
No off target data available for this crispr