ID: 938214470

View in Genome Browser
Species Human (GRCh38)
Location 2:129499209-129499231
Sequence CAATTGGGAAAGAAAATCGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938214462_938214470 10 Left 938214462 2:129499176-129499198 CCACCTCACACTGTACTGGAGGG No data
Right 938214470 2:129499209-129499231 CAATTGGGAAAGAAAATCGTAGG No data
938214459_938214470 23 Left 938214459 2:129499163-129499185 CCTCTCACTACTTCCACCTCACA No data
Right 938214470 2:129499209-129499231 CAATTGGGAAAGAAAATCGTAGG No data
938214464_938214470 7 Left 938214464 2:129499179-129499201 CCTCACACTGTACTGGAGGGCTA No data
Right 938214470 2:129499209-129499231 CAATTGGGAAAGAAAATCGTAGG No data
938214457_938214470 25 Left 938214457 2:129499161-129499183 CCCCTCTCACTACTTCCACCTCA No data
Right 938214470 2:129499209-129499231 CAATTGGGAAAGAAAATCGTAGG No data
938214458_938214470 24 Left 938214458 2:129499162-129499184 CCCTCTCACTACTTCCACCTCAC No data
Right 938214470 2:129499209-129499231 CAATTGGGAAAGAAAATCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938214470 Original CRISPR CAATTGGGAAAGAAAATCGT AGG Intergenic
No off target data available for this crispr