ID: 938217030

View in Genome Browser
Species Human (GRCh38)
Location 2:129526726-129526748
Sequence AGCCCAGCAATACTCCCAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938217027_938217030 6 Left 938217027 2:129526697-129526719 CCGTTGGACCTTAACAGAACATC No data
Right 938217030 2:129526726-129526748 AGCCCAGCAATACTCCCAATGGG No data
938217028_938217030 -2 Left 938217028 2:129526705-129526727 CCTTAACAGAACATCAGCAGTAG No data
Right 938217030 2:129526726-129526748 AGCCCAGCAATACTCCCAATGGG No data
938217025_938217030 25 Left 938217025 2:129526678-129526700 CCACAAGCTGATCAAAGAGCCGT No data
Right 938217030 2:129526726-129526748 AGCCCAGCAATACTCCCAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938217030 Original CRISPR AGCCCAGCAATACTCCCAAT GGG Intergenic
No off target data available for this crispr