ID: 938222864

View in Genome Browser
Species Human (GRCh38)
Location 2:129587031-129587053
Sequence GAAAGCTTACCCTTCTATGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938222862_938222864 12 Left 938222862 2:129586996-129587018 CCATCTCTGGCGACAGATGTTTC No data
Right 938222864 2:129587031-129587053 GAAAGCTTACCCTTCTATGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938222864 Original CRISPR GAAAGCTTACCCTTCTATGG CGG Intergenic
No off target data available for this crispr