ID: 938224919

View in Genome Browser
Species Human (GRCh38)
Location 2:129607320-129607342
Sequence TGCCCACCCCAACCCAAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938224914_938224919 -2 Left 938224914 2:129607299-129607321 CCTGGAGCTTTCCCGGGGCACTG No data
Right 938224919 2:129607320-129607342 TGCCCACCCCAACCCAAAAGGGG No data
938224909_938224919 10 Left 938224909 2:129607287-129607309 CCCGAGAGCATGCCTGGAGCTTT No data
Right 938224919 2:129607320-129607342 TGCCCACCCCAACCCAAAAGGGG No data
938224910_938224919 9 Left 938224910 2:129607288-129607310 CCGAGAGCATGCCTGGAGCTTTC No data
Right 938224919 2:129607320-129607342 TGCCCACCCCAACCCAAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938224919 Original CRISPR TGCCCACCCCAACCCAAAAG GGG Intergenic
No off target data available for this crispr