ID: 938225173

View in Genome Browser
Species Human (GRCh38)
Location 2:129609628-129609650
Sequence TAAATCAGCCCAGTGACCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938225173_938225175 3 Left 938225173 2:129609628-129609650 CCTGAGGTCACTGGGCTGATTTA No data
Right 938225175 2:129609654-129609676 CAATCCAGATGAGCTCTCTGAGG No data
938225173_938225178 17 Left 938225173 2:129609628-129609650 CCTGAGGTCACTGGGCTGATTTA No data
Right 938225178 2:129609668-129609690 TCTCTGAGGCTGGACAGCTCAGG No data
938225173_938225179 18 Left 938225173 2:129609628-129609650 CCTGAGGTCACTGGGCTGATTTA No data
Right 938225179 2:129609669-129609691 CTCTGAGGCTGGACAGCTCAGGG No data
938225173_938225177 7 Left 938225173 2:129609628-129609650 CCTGAGGTCACTGGGCTGATTTA No data
Right 938225177 2:129609658-129609680 CCAGATGAGCTCTCTGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938225173 Original CRISPR TAAATCAGCCCAGTGACCTC AGG (reversed) Intergenic