ID: 938225174

View in Genome Browser
Species Human (GRCh38)
Location 2:129609653-129609675
Sequence CTCAGAGAGCTCATCTGGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938225174_938225180 10 Left 938225174 2:129609653-129609675 CCAATCCAGATGAGCTCTCTGAG No data
Right 938225180 2:129609686-129609708 TCAGGGCTCACAGAAGAGAATGG No data
938225174_938225178 -8 Left 938225174 2:129609653-129609675 CCAATCCAGATGAGCTCTCTGAG No data
Right 938225178 2:129609668-129609690 TCTCTGAGGCTGGACAGCTCAGG No data
938225174_938225179 -7 Left 938225174 2:129609653-129609675 CCAATCCAGATGAGCTCTCTGAG No data
Right 938225179 2:129609669-129609691 CTCTGAGGCTGGACAGCTCAGGG No data
938225174_938225181 26 Left 938225174 2:129609653-129609675 CCAATCCAGATGAGCTCTCTGAG No data
Right 938225181 2:129609702-129609724 AGAATGGATACCTTAAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938225174 Original CRISPR CTCAGAGAGCTCATCTGGAT TGG (reversed) Intergenic