ID: 938225178

View in Genome Browser
Species Human (GRCh38)
Location 2:129609668-129609690
Sequence TCTCTGAGGCTGGACAGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938225173_938225178 17 Left 938225173 2:129609628-129609650 CCTGAGGTCACTGGGCTGATTTA No data
Right 938225178 2:129609668-129609690 TCTCTGAGGCTGGACAGCTCAGG No data
938225174_938225178 -8 Left 938225174 2:129609653-129609675 CCAATCCAGATGAGCTCTCTGAG No data
Right 938225178 2:129609668-129609690 TCTCTGAGGCTGGACAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938225178 Original CRISPR TCTCTGAGGCTGGACAGCTC AGG Intergenic