ID: 938225179 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:129609669-129609691 |
Sequence | CTCTGAGGCTGGACAGCTCA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
938225174_938225179 | -7 | Left | 938225174 | 2:129609653-129609675 | CCAATCCAGATGAGCTCTCTGAG | No data | ||
Right | 938225179 | 2:129609669-129609691 | CTCTGAGGCTGGACAGCTCAGGG | No data | ||||
938225173_938225179 | 18 | Left | 938225173 | 2:129609628-129609650 | CCTGAGGTCACTGGGCTGATTTA | No data | ||
Right | 938225179 | 2:129609669-129609691 | CTCTGAGGCTGGACAGCTCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
938225179 | Original CRISPR | CTCTGAGGCTGGACAGCTCA GGG | Intergenic | ||