ID: 938225179

View in Genome Browser
Species Human (GRCh38)
Location 2:129609669-129609691
Sequence CTCTGAGGCTGGACAGCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938225174_938225179 -7 Left 938225174 2:129609653-129609675 CCAATCCAGATGAGCTCTCTGAG No data
Right 938225179 2:129609669-129609691 CTCTGAGGCTGGACAGCTCAGGG No data
938225173_938225179 18 Left 938225173 2:129609628-129609650 CCTGAGGTCACTGGGCTGATTTA No data
Right 938225179 2:129609669-129609691 CTCTGAGGCTGGACAGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938225179 Original CRISPR CTCTGAGGCTGGACAGCTCA GGG Intergenic