ID: 938225181

View in Genome Browser
Species Human (GRCh38)
Location 2:129609702-129609724
Sequence AGAATGGATACCTTAAAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938225176_938225181 21 Left 938225176 2:129609658-129609680 CCAGATGAGCTCTCTGAGGCTGG No data
Right 938225181 2:129609702-129609724 AGAATGGATACCTTAAAAATTGG No data
938225174_938225181 26 Left 938225174 2:129609653-129609675 CCAATCCAGATGAGCTCTCTGAG No data
Right 938225181 2:129609702-129609724 AGAATGGATACCTTAAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938225181 Original CRISPR AGAATGGATACCTTAAAAAT TGG Intergenic