ID: 938225419

View in Genome Browser
Species Human (GRCh38)
Location 2:129611702-129611724
Sequence GACACAGATGTGCATCTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938225419_938225423 19 Left 938225419 2:129611702-129611724 CCCGCCAGATGCACATCTGTGTC No data
Right 938225423 2:129611744-129611766 TCCTGTGCAAGTCTCACCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938225419 Original CRISPR GACACAGATGTGCATCTGGC GGG (reversed) Intergenic
No off target data available for this crispr