ID: 938228655

View in Genome Browser
Species Human (GRCh38)
Location 2:129639050-129639072
Sequence TACTTCCCATTTTACATATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938228655_938228657 16 Left 938228655 2:129639050-129639072 CCTTATATGTAAAATGGGAAGTA No data
Right 938228657 2:129639089-129639111 GATTTTTCAAGGTTTCCATATGG No data
938228655_938228656 5 Left 938228655 2:129639050-129639072 CCTTATATGTAAAATGGGAAGTA No data
Right 938228656 2:129639078-129639100 AAAAAACTTCTGATTTTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938228655 Original CRISPR TACTTCCCATTTTACATATA AGG (reversed) Intergenic
No off target data available for this crispr