ID: 938228904

View in Genome Browser
Species Human (GRCh38)
Location 2:129640876-129640898
Sequence TACTTCCCATTTTACATGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938228903_938228904 6 Left 938228903 2:129640847-129640869 CCTTGAAAAATCAGAAGTTTTTT No data
Right 938228904 2:129640876-129640898 TACTTCCCATTTTACATGTAAGG No data
938228902_938228904 17 Left 938228902 2:129640836-129640858 CCATATGGAAACCTTGAAAAATC No data
Right 938228904 2:129640876-129640898 TACTTCCCATTTTACATGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938228904 Original CRISPR TACTTCCCATTTTACATGTA AGG Intergenic
No off target data available for this crispr