ID: 938229422

View in Genome Browser
Species Human (GRCh38)
Location 2:129645754-129645776
Sequence GGAGGTAGTGGACCTCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938229422_938229431 30 Left 938229422 2:129645754-129645776 CCAGGGTGAGGTCCACTACCTCC No data
Right 938229431 2:129645807-129645829 GCAGTTTCCTGGCAGTGGAGAGG No data
938229422_938229429 19 Left 938229422 2:129645754-129645776 CCAGGGTGAGGTCCACTACCTCC No data
Right 938229429 2:129645796-129645818 CATGCAGTAGAGCAGTTTCCTGG No data
938229422_938229430 25 Left 938229422 2:129645754-129645776 CCAGGGTGAGGTCCACTACCTCC No data
Right 938229430 2:129645802-129645824 GTAGAGCAGTTTCCTGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938229422 Original CRISPR GGAGGTAGTGGACCTCACCC TGG (reversed) Intergenic
No off target data available for this crispr