ID: 938229460 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:129646001-129646023 |
| Sequence | CTGTGGACAAGGAGCCATGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 938229460_938229467 | 23 | Left | 938229460 | 2:129646001-129646023 | CCAGCATGGCTCCTTGTCCACAG | No data | ||
| Right | 938229467 | 2:129646047-129646069 | TCCACAGCAGTGACCCAGCATGG | No data | ||||
| 938229460_938229462 | -7 | Left | 938229460 | 2:129646001-129646023 | CCAGCATGGCTCCTTGTCCACAG | No data | ||
| Right | 938229462 | 2:129646017-129646039 | TCCACAGCAGTGACCCAGCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 938229460 | Original CRISPR | CTGTGGACAAGGAGCCATGC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||