ID: 938229460

View in Genome Browser
Species Human (GRCh38)
Location 2:129646001-129646023
Sequence CTGTGGACAAGGAGCCATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938229460_938229467 23 Left 938229460 2:129646001-129646023 CCAGCATGGCTCCTTGTCCACAG No data
Right 938229467 2:129646047-129646069 TCCACAGCAGTGACCCAGCATGG No data
938229460_938229462 -7 Left 938229460 2:129646001-129646023 CCAGCATGGCTCCTTGTCCACAG No data
Right 938229462 2:129646017-129646039 TCCACAGCAGTGACCCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938229460 Original CRISPR CTGTGGACAAGGAGCCATGC TGG (reversed) Intergenic
No off target data available for this crispr