ID: 938230057

View in Genome Browser
Species Human (GRCh38)
Location 2:129650634-129650656
Sequence TGCCCCGTGGTAGCTGGGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938230057_938230066 20 Left 938230057 2:129650634-129650656 CCGGTCCCAGCTACCACGGGGCA No data
Right 938230066 2:129650677-129650699 CCTGAAACACCTGCCTCTATGGG No data
938230057_938230068 24 Left 938230057 2:129650634-129650656 CCGGTCCCAGCTACCACGGGGCA No data
Right 938230068 2:129650681-129650703 AAACACCTGCCTCTATGGGTGGG No data
938230057_938230064 19 Left 938230057 2:129650634-129650656 CCGGTCCCAGCTACCACGGGGCA No data
Right 938230064 2:129650676-129650698 TCCTGAAACACCTGCCTCTATGG No data
938230057_938230070 29 Left 938230057 2:129650634-129650656 CCGGTCCCAGCTACCACGGGGCA No data
Right 938230070 2:129650686-129650708 CCTGCCTCTATGGGTGGGCTTGG No data
938230057_938230067 23 Left 938230057 2:129650634-129650656 CCGGTCCCAGCTACCACGGGGCA No data
Right 938230067 2:129650680-129650702 GAAACACCTGCCTCTATGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938230057 Original CRISPR TGCCCCGTGGTAGCTGGGAC CGG (reversed) Intergenic
No off target data available for this crispr