ID: 938230058

View in Genome Browser
Species Human (GRCh38)
Location 2:129650639-129650661
Sequence AAGGCTGCCCCGTGGTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938230058_938230071 27 Left 938230058 2:129650639-129650661 CCCAGCTACCACGGGGCAGCCTT No data
Right 938230071 2:129650689-129650711 GCCTCTATGGGTGGGCTTGGAGG No data
938230058_938230067 18 Left 938230058 2:129650639-129650661 CCCAGCTACCACGGGGCAGCCTT No data
Right 938230067 2:129650680-129650702 GAAACACCTGCCTCTATGGGTGG No data
938230058_938230064 14 Left 938230058 2:129650639-129650661 CCCAGCTACCACGGGGCAGCCTT No data
Right 938230064 2:129650676-129650698 TCCTGAAACACCTGCCTCTATGG No data
938230058_938230066 15 Left 938230058 2:129650639-129650661 CCCAGCTACCACGGGGCAGCCTT No data
Right 938230066 2:129650677-129650699 CCTGAAACACCTGCCTCTATGGG No data
938230058_938230070 24 Left 938230058 2:129650639-129650661 CCCAGCTACCACGGGGCAGCCTT No data
Right 938230070 2:129650686-129650708 CCTGCCTCTATGGGTGGGCTTGG No data
938230058_938230068 19 Left 938230058 2:129650639-129650661 CCCAGCTACCACGGGGCAGCCTT No data
Right 938230068 2:129650681-129650703 AAACACCTGCCTCTATGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938230058 Original CRISPR AAGGCTGCCCCGTGGTAGCT GGG (reversed) Intergenic