ID: 938230062

View in Genome Browser
Species Human (GRCh38)
Location 2:129650663-129650685
Sequence TGTTTCAGGAAGTCTGGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938230062_938230070 0 Left 938230062 2:129650663-129650685 CCACATCCAGACTTCCTGAAACA No data
Right 938230070 2:129650686-129650708 CCTGCCTCTATGGGTGGGCTTGG No data
938230062_938230067 -6 Left 938230062 2:129650663-129650685 CCACATCCAGACTTCCTGAAACA No data
Right 938230067 2:129650680-129650702 GAAACACCTGCCTCTATGGGTGG No data
938230062_938230068 -5 Left 938230062 2:129650663-129650685 CCACATCCAGACTTCCTGAAACA No data
Right 938230068 2:129650681-129650703 AAACACCTGCCTCTATGGGTGGG No data
938230062_938230064 -10 Left 938230062 2:129650663-129650685 CCACATCCAGACTTCCTGAAACA No data
Right 938230064 2:129650676-129650698 TCCTGAAACACCTGCCTCTATGG No data
938230062_938230066 -9 Left 938230062 2:129650663-129650685 CCACATCCAGACTTCCTGAAACA No data
Right 938230066 2:129650677-129650699 CCTGAAACACCTGCCTCTATGGG No data
938230062_938230071 3 Left 938230062 2:129650663-129650685 CCACATCCAGACTTCCTGAAACA No data
Right 938230071 2:129650689-129650711 GCCTCTATGGGTGGGCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938230062 Original CRISPR TGTTTCAGGAAGTCTGGATG TGG (reversed) Intergenic
No off target data available for this crispr