ID: 938230064

View in Genome Browser
Species Human (GRCh38)
Location 2:129650676-129650698
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938230057_938230064 19 Left 938230057 2:129650634-129650656 CCGGTCCCAGCTACCACGGGGCA No data
Right 938230064 2:129650676-129650698 TCCTGAAACACCTGCCTCTATGG No data
938230058_938230064 14 Left 938230058 2:129650639-129650661 CCCAGCTACCACGGGGCAGCCTT No data
Right 938230064 2:129650676-129650698 TCCTGAAACACCTGCCTCTATGG No data
938230060_938230064 6 Left 938230060 2:129650647-129650669 CCACGGGGCAGCCTTACCACATC No data
Right 938230064 2:129650676-129650698 TCCTGAAACACCTGCCTCTATGG No data
938230062_938230064 -10 Left 938230062 2:129650663-129650685 CCACATCCAGACTTCCTGAAACA No data
Right 938230064 2:129650676-129650698 TCCTGAAACACCTGCCTCTATGG No data
938230061_938230064 -5 Left 938230061 2:129650658-129650680 CCTTACCACATCCAGACTTCCTG No data
Right 938230064 2:129650676-129650698 TCCTGAAACACCTGCCTCTATGG No data
938230059_938230064 13 Left 938230059 2:129650640-129650662 CCAGCTACCACGGGGCAGCCTTA No data
Right 938230064 2:129650676-129650698 TCCTGAAACACCTGCCTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type