ID: 938230068

View in Genome Browser
Species Human (GRCh38)
Location 2:129650681-129650703
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938230058_938230068 19 Left 938230058 2:129650639-129650661 CCCAGCTACCACGGGGCAGCCTT No data
Right 938230068 2:129650681-129650703 AAACACCTGCCTCTATGGGTGGG No data
938230059_938230068 18 Left 938230059 2:129650640-129650662 CCAGCTACCACGGGGCAGCCTTA No data
Right 938230068 2:129650681-129650703 AAACACCTGCCTCTATGGGTGGG No data
938230062_938230068 -5 Left 938230062 2:129650663-129650685 CCACATCCAGACTTCCTGAAACA No data
Right 938230068 2:129650681-129650703 AAACACCTGCCTCTATGGGTGGG No data
938230060_938230068 11 Left 938230060 2:129650647-129650669 CCACGGGGCAGCCTTACCACATC No data
Right 938230068 2:129650681-129650703 AAACACCTGCCTCTATGGGTGGG No data
938230061_938230068 0 Left 938230061 2:129650658-129650680 CCTTACCACATCCAGACTTCCTG No data
Right 938230068 2:129650681-129650703 AAACACCTGCCTCTATGGGTGGG No data
938230057_938230068 24 Left 938230057 2:129650634-129650656 CCGGTCCCAGCTACCACGGGGCA No data
Right 938230068 2:129650681-129650703 AAACACCTGCCTCTATGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type