ID: 938230070

View in Genome Browser
Species Human (GRCh38)
Location 2:129650686-129650708
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938230060_938230070 16 Left 938230060 2:129650647-129650669 CCACGGGGCAGCCTTACCACATC No data
Right 938230070 2:129650686-129650708 CCTGCCTCTATGGGTGGGCTTGG No data
938230057_938230070 29 Left 938230057 2:129650634-129650656 CCGGTCCCAGCTACCACGGGGCA No data
Right 938230070 2:129650686-129650708 CCTGCCTCTATGGGTGGGCTTGG No data
938230058_938230070 24 Left 938230058 2:129650639-129650661 CCCAGCTACCACGGGGCAGCCTT No data
Right 938230070 2:129650686-129650708 CCTGCCTCTATGGGTGGGCTTGG No data
938230062_938230070 0 Left 938230062 2:129650663-129650685 CCACATCCAGACTTCCTGAAACA No data
Right 938230070 2:129650686-129650708 CCTGCCTCTATGGGTGGGCTTGG No data
938230063_938230070 -6 Left 938230063 2:129650669-129650691 CCAGACTTCCTGAAACACCTGCC No data
Right 938230070 2:129650686-129650708 CCTGCCTCTATGGGTGGGCTTGG No data
938230059_938230070 23 Left 938230059 2:129650640-129650662 CCAGCTACCACGGGGCAGCCTTA No data
Right 938230070 2:129650686-129650708 CCTGCCTCTATGGGTGGGCTTGG No data
938230061_938230070 5 Left 938230061 2:129650658-129650680 CCTTACCACATCCAGACTTCCTG No data
Right 938230070 2:129650686-129650708 CCTGCCTCTATGGGTGGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type