ID: 938230071

View in Genome Browser
Species Human (GRCh38)
Location 2:129650689-129650711
Sequence GCCTCTATGGGTGGGCTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938230059_938230071 26 Left 938230059 2:129650640-129650662 CCAGCTACCACGGGGCAGCCTTA No data
Right 938230071 2:129650689-129650711 GCCTCTATGGGTGGGCTTGGAGG No data
938230062_938230071 3 Left 938230062 2:129650663-129650685 CCACATCCAGACTTCCTGAAACA No data
Right 938230071 2:129650689-129650711 GCCTCTATGGGTGGGCTTGGAGG No data
938230063_938230071 -3 Left 938230063 2:129650669-129650691 CCAGACTTCCTGAAACACCTGCC No data
Right 938230071 2:129650689-129650711 GCCTCTATGGGTGGGCTTGGAGG No data
938230061_938230071 8 Left 938230061 2:129650658-129650680 CCTTACCACATCCAGACTTCCTG No data
Right 938230071 2:129650689-129650711 GCCTCTATGGGTGGGCTTGGAGG No data
938230060_938230071 19 Left 938230060 2:129650647-129650669 CCACGGGGCAGCCTTACCACATC No data
Right 938230071 2:129650689-129650711 GCCTCTATGGGTGGGCTTGGAGG No data
938230058_938230071 27 Left 938230058 2:129650639-129650661 CCCAGCTACCACGGGGCAGCCTT No data
Right 938230071 2:129650689-129650711 GCCTCTATGGGTGGGCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938230071 Original CRISPR GCCTCTATGGGTGGGCTTGG AGG Intergenic