ID: 938230617

View in Genome Browser
Species Human (GRCh38)
Location 2:129655605-129655627
Sequence TTGACTCCAGAACTTTACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938230617_938230623 12 Left 938230617 2:129655605-129655627 CCTTTGTAAAGTTCTGGAGTCAA No data
Right 938230623 2:129655640-129655662 AACTGATGGACTCTGGAGTCAGG No data
938230617_938230621 -2 Left 938230617 2:129655605-129655627 CCTTTGTAAAGTTCTGGAGTCAA No data
Right 938230621 2:129655626-129655648 AACAATACAGGGGAAACTGATGG No data
938230617_938230625 21 Left 938230617 2:129655605-129655627 CCTTTGTAAAGTTCTGGAGTCAA No data
Right 938230625 2:129655649-129655671 ACTCTGGAGTCAGGTGGACTTGG No data
938230617_938230622 5 Left 938230617 2:129655605-129655627 CCTTTGTAAAGTTCTGGAGTCAA No data
Right 938230622 2:129655633-129655655 CAGGGGAAACTGATGGACTCTGG No data
938230617_938230624 15 Left 938230617 2:129655605-129655627 CCTTTGTAAAGTTCTGGAGTCAA No data
Right 938230624 2:129655643-129655665 TGATGGACTCTGGAGTCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938230617 Original CRISPR TTGACTCCAGAACTTTACAA AGG (reversed) Intergenic
No off target data available for this crispr