ID: 938230622

View in Genome Browser
Species Human (GRCh38)
Location 2:129655633-129655655
Sequence CAGGGGAAACTGATGGACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938230617_938230622 5 Left 938230617 2:129655605-129655627 CCTTTGTAAAGTTCTGGAGTCAA No data
Right 938230622 2:129655633-129655655 CAGGGGAAACTGATGGACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938230622 Original CRISPR CAGGGGAAACTGATGGACTC TGG Intergenic
No off target data available for this crispr