ID: 938232359

View in Genome Browser
Species Human (GRCh38)
Location 2:129672212-129672234
Sequence CAATATCCAATGATGGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938232359_938232365 -8 Left 938232359 2:129672212-129672234 CCCTGTTCCATCATTGGATATTG No data
Right 938232365 2:129672227-129672249 GGATATTGCAAAGGATTGAGGGG No data
938232359_938232366 -7 Left 938232359 2:129672212-129672234 CCCTGTTCCATCATTGGATATTG No data
Right 938232366 2:129672228-129672250 GATATTGCAAAGGATTGAGGGGG No data
938232359_938232364 -9 Left 938232359 2:129672212-129672234 CCCTGTTCCATCATTGGATATTG No data
Right 938232364 2:129672226-129672248 TGGATATTGCAAAGGATTGAGGG No data
938232359_938232363 -10 Left 938232359 2:129672212-129672234 CCCTGTTCCATCATTGGATATTG No data
Right 938232363 2:129672225-129672247 TTGGATATTGCAAAGGATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938232359 Original CRISPR CAATATCCAATGATGGAACA GGG (reversed) Intergenic
No off target data available for this crispr