ID: 938234872

View in Genome Browser
Species Human (GRCh38)
Location 2:129697775-129697797
Sequence AGATGTACACTTCGAATGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938234869_938234872 10 Left 938234869 2:129697742-129697764 CCATCTCAAAAGAAAAAAAAAAA 0: 814
1: 85575
2: 63985
3: 83290
4: 120228
Right 938234872 2:129697775-129697797 AGATGTACACTTCGAATGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938234872 Original CRISPR AGATGTACACTTCGAATGGG TGG Intergenic
No off target data available for this crispr