ID: 938235517

View in Genome Browser
Species Human (GRCh38)
Location 2:129703192-129703214
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938235517_938235522 23 Left 938235517 2:129703192-129703214 CCATTTTCACACTGCTAATACAG No data
Right 938235522 2:129703238-129703260 GTAAAGAAAAAGAGGTTTAATGG 0: 58
1: 1471
2: 1806
3: 1321
4: 1447
938235517_938235521 15 Left 938235517 2:129703192-129703214 CCATTTTCACACTGCTAATACAG No data
Right 938235521 2:129703230-129703252 GGTAATTCGTAAAGAAAAAGAGG No data
938235517_938235518 -7 Left 938235517 2:129703192-129703214 CCATTTTCACACTGCTAATACAG No data
Right 938235518 2:129703208-129703230 AATACAGACATACCTGAGACTGG 0: 10
1: 1139
2: 3743
3: 7263
4: 10720
938235517_938235519 -6 Left 938235517 2:129703192-129703214 CCATTTTCACACTGCTAATACAG No data
Right 938235519 2:129703209-129703231 ATACAGACATACCTGAGACTGGG 0: 20
1: 2868
2: 6273
3: 10635
4: 11288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938235517 Original CRISPR CTGTATTAGCAGTGTGAAAA TGG (reversed) Intergenic
No off target data available for this crispr