ID: 938236497

View in Genome Browser
Species Human (GRCh38)
Location 2:129710389-129710411
Sequence AGACATGGCCAGAGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938236488_938236497 15 Left 938236488 2:129710351-129710373 CCGGCTCAGAGTACAGCCAGGAC No data
Right 938236497 2:129710389-129710411 AGACATGGCCAGAGGGCAGAGGG No data
938236491_938236497 -1 Left 938236491 2:129710367-129710389 CCAGGACCAAGAGATGGTGGTAA No data
Right 938236497 2:129710389-129710411 AGACATGGCCAGAGGGCAGAGGG No data
938236492_938236497 -7 Left 938236492 2:129710373-129710395 CCAAGAGATGGTGGTAAGACATG No data
Right 938236497 2:129710389-129710411 AGACATGGCCAGAGGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938236497 Original CRISPR AGACATGGCCAGAGGGCAGA GGG Intergenic
No off target data available for this crispr