ID: 938238350

View in Genome Browser
Species Human (GRCh38)
Location 2:129724044-129724066
Sequence TGGGAAGCAGAATTGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938238350_938238366 27 Left 938238350 2:129724044-129724066 CCCTGCTCCAATTCTGCTTCCCA No data
Right 938238366 2:129724094-129724116 CATCCAGGGTGGCTTGGATTTGG No data
938238350_938238355 -7 Left 938238350 2:129724044-129724066 CCCTGCTCCAATTCTGCTTCCCA No data
Right 938238355 2:129724060-129724082 CTTCCCAGGCTCTGACTGCTGGG No data
938238350_938238362 12 Left 938238350 2:129724044-129724066 CCCTGCTCCAATTCTGCTTCCCA No data
Right 938238362 2:129724079-129724101 TGGGGTGGGGAGAGTCATCCAGG No data
938238350_938238354 -8 Left 938238350 2:129724044-129724066 CCCTGCTCCAATTCTGCTTCCCA No data
Right 938238354 2:129724059-129724081 GCTTCCCAGGCTCTGACTGCTGG No data
938238350_938238363 13 Left 938238350 2:129724044-129724066 CCCTGCTCCAATTCTGCTTCCCA No data
Right 938238363 2:129724080-129724102 GGGGTGGGGAGAGTCATCCAGGG No data
938238350_938238356 -6 Left 938238350 2:129724044-129724066 CCCTGCTCCAATTCTGCTTCCCA No data
Right 938238356 2:129724061-129724083 TTCCCAGGCTCTGACTGCTGGGG No data
938238350_938238360 -2 Left 938238350 2:129724044-129724066 CCCTGCTCCAATTCTGCTTCCCA No data
Right 938238360 2:129724065-129724087 CAGGCTCTGACTGCTGGGGTGGG No data
938238350_938238359 -3 Left 938238350 2:129724044-129724066 CCCTGCTCCAATTCTGCTTCCCA No data
Right 938238359 2:129724064-129724086 CCAGGCTCTGACTGCTGGGGTGG No data
938238350_938238365 21 Left 938238350 2:129724044-129724066 CCCTGCTCCAATTCTGCTTCCCA No data
Right 938238365 2:129724088-129724110 GAGAGTCATCCAGGGTGGCTTGG No data
938238350_938238361 -1 Left 938238350 2:129724044-129724066 CCCTGCTCCAATTCTGCTTCCCA No data
Right 938238361 2:129724066-129724088 AGGCTCTGACTGCTGGGGTGGGG No data
938238350_938238364 16 Left 938238350 2:129724044-129724066 CCCTGCTCCAATTCTGCTTCCCA No data
Right 938238364 2:129724083-129724105 GTGGGGAGAGTCATCCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938238350 Original CRISPR TGGGAAGCAGAATTGGAGCA GGG (reversed) Intergenic
No off target data available for this crispr