ID: 938244941

View in Genome Browser
Species Human (GRCh38)
Location 2:129769093-129769115
Sequence GCTCACCTGCAGAGGCTGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938244941_938244946 9 Left 938244941 2:129769093-129769115 CCCGTCAGCCTCTGCAGGTGAGC No data
Right 938244946 2:129769125-129769147 ATCCGAGCTCAAAACACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938244941 Original CRISPR GCTCACCTGCAGAGGCTGAC GGG (reversed) Intergenic
No off target data available for this crispr