ID: 938246775

View in Genome Browser
Species Human (GRCh38)
Location 2:129782964-129782986
Sequence GCAATTTCTGGACCCCACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938246775_938246784 23 Left 938246775 2:129782964-129782986 CCACTGTGGGGTCCAGAAATTGC No data
Right 938246784 2:129783010-129783032 GGGATGGGAGTGTGCACGCCAGG No data
938246775_938246778 2 Left 938246775 2:129782964-129782986 CCACTGTGGGGTCCAGAAATTGC No data
Right 938246778 2:129782989-129783011 CCATCCTAAACCTGCATCTGTGG No data
938246775_938246785 29 Left 938246775 2:129782964-129782986 CCACTGTGGGGTCCAGAAATTGC No data
Right 938246785 2:129783016-129783038 GGAGTGTGCACGCCAGGTCGTGG No data
938246775_938246779 3 Left 938246775 2:129782964-129782986 CCACTGTGGGGTCCAGAAATTGC No data
Right 938246779 2:129782990-129783012 CATCCTAAACCTGCATCTGTGGG No data
938246775_938246781 7 Left 938246775 2:129782964-129782986 CCACTGTGGGGTCCAGAAATTGC No data
Right 938246781 2:129782994-129783016 CTAAACCTGCATCTGTGGGATGG No data
938246775_938246782 8 Left 938246775 2:129782964-129782986 CCACTGTGGGGTCCAGAAATTGC No data
Right 938246782 2:129782995-129783017 TAAACCTGCATCTGTGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938246775 Original CRISPR GCAATTTCTGGACCCCACAG TGG (reversed) Intergenic