ID: 938248463

View in Genome Browser
Species Human (GRCh38)
Location 2:129796476-129796498
Sequence CCTTCACTGCAGTGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938248463_938248469 -4 Left 938248463 2:129796476-129796498 CCAGCTTCCCACTGCAGTGAAGG No data
Right 938248469 2:129796495-129796517 AAGGTCGATTGGTTGTCACAGGG No data
938248463_938248470 -3 Left 938248463 2:129796476-129796498 CCAGCTTCCCACTGCAGTGAAGG No data
Right 938248470 2:129796496-129796518 AGGTCGATTGGTTGTCACAGGGG No data
938248463_938248473 6 Left 938248463 2:129796476-129796498 CCAGCTTCCCACTGCAGTGAAGG No data
Right 938248473 2:129796505-129796527 GGTTGTCACAGGGGCAGCTGGGG No data
938248463_938248468 -5 Left 938248463 2:129796476-129796498 CCAGCTTCCCACTGCAGTGAAGG No data
Right 938248468 2:129796494-129796516 GAAGGTCGATTGGTTGTCACAGG No data
938248463_938248471 4 Left 938248463 2:129796476-129796498 CCAGCTTCCCACTGCAGTGAAGG No data
Right 938248471 2:129796503-129796525 TTGGTTGTCACAGGGGCAGCTGG No data
938248463_938248472 5 Left 938248463 2:129796476-129796498 CCAGCTTCCCACTGCAGTGAAGG No data
Right 938248472 2:129796504-129796526 TGGTTGTCACAGGGGCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938248463 Original CRISPR CCTTCACTGCAGTGGGAAGC TGG (reversed) Intergenic
No off target data available for this crispr