ID: 938248468

View in Genome Browser
Species Human (GRCh38)
Location 2:129796494-129796516
Sequence GAAGGTCGATTGGTTGTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938248463_938248468 -5 Left 938248463 2:129796476-129796498 CCAGCTTCCCACTGCAGTGAAGG No data
Right 938248468 2:129796494-129796516 GAAGGTCGATTGGTTGTCACAGG No data
938248458_938248468 22 Left 938248458 2:129796449-129796471 CCAGGGCCTTCTTGGGGGTGACC No data
Right 938248468 2:129796494-129796516 GAAGGTCGATTGGTTGTCACAGG No data
938248460_938248468 16 Left 938248460 2:129796455-129796477 CCTTCTTGGGGGTGACCCTGGCC No data
Right 938248468 2:129796494-129796516 GAAGGTCGATTGGTTGTCACAGG No data
938248455_938248468 25 Left 938248455 2:129796446-129796468 CCCCCAGGGCCTTCTTGGGGGTG No data
Right 938248468 2:129796494-129796516 GAAGGTCGATTGGTTGTCACAGG No data
938248462_938248468 0 Left 938248462 2:129796471-129796493 CCTGGCCAGCTTCCCACTGCAGT No data
Right 938248468 2:129796494-129796516 GAAGGTCGATTGGTTGTCACAGG No data
938248456_938248468 24 Left 938248456 2:129796447-129796469 CCCCAGGGCCTTCTTGGGGGTGA No data
Right 938248468 2:129796494-129796516 GAAGGTCGATTGGTTGTCACAGG No data
938248461_938248468 1 Left 938248461 2:129796470-129796492 CCCTGGCCAGCTTCCCACTGCAG No data
Right 938248468 2:129796494-129796516 GAAGGTCGATTGGTTGTCACAGG No data
938248457_938248468 23 Left 938248457 2:129796448-129796470 CCCAGGGCCTTCTTGGGGGTGAC No data
Right 938248468 2:129796494-129796516 GAAGGTCGATTGGTTGTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938248468 Original CRISPR GAAGGTCGATTGGTTGTCAC AGG Intergenic
No off target data available for this crispr