ID: 938248469

View in Genome Browser
Species Human (GRCh38)
Location 2:129796495-129796517
Sequence AAGGTCGATTGGTTGTCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938248457_938248469 24 Left 938248457 2:129796448-129796470 CCCAGGGCCTTCTTGGGGGTGAC No data
Right 938248469 2:129796495-129796517 AAGGTCGATTGGTTGTCACAGGG No data
938248463_938248469 -4 Left 938248463 2:129796476-129796498 CCAGCTTCCCACTGCAGTGAAGG No data
Right 938248469 2:129796495-129796517 AAGGTCGATTGGTTGTCACAGGG No data
938248458_938248469 23 Left 938248458 2:129796449-129796471 CCAGGGCCTTCTTGGGGGTGACC No data
Right 938248469 2:129796495-129796517 AAGGTCGATTGGTTGTCACAGGG No data
938248462_938248469 1 Left 938248462 2:129796471-129796493 CCTGGCCAGCTTCCCACTGCAGT No data
Right 938248469 2:129796495-129796517 AAGGTCGATTGGTTGTCACAGGG No data
938248461_938248469 2 Left 938248461 2:129796470-129796492 CCCTGGCCAGCTTCCCACTGCAG No data
Right 938248469 2:129796495-129796517 AAGGTCGATTGGTTGTCACAGGG No data
938248460_938248469 17 Left 938248460 2:129796455-129796477 CCTTCTTGGGGGTGACCCTGGCC No data
Right 938248469 2:129796495-129796517 AAGGTCGATTGGTTGTCACAGGG No data
938248456_938248469 25 Left 938248456 2:129796447-129796469 CCCCAGGGCCTTCTTGGGGGTGA No data
Right 938248469 2:129796495-129796517 AAGGTCGATTGGTTGTCACAGGG No data
938248455_938248469 26 Left 938248455 2:129796446-129796468 CCCCCAGGGCCTTCTTGGGGGTG No data
Right 938248469 2:129796495-129796517 AAGGTCGATTGGTTGTCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938248469 Original CRISPR AAGGTCGATTGGTTGTCACA GGG Intergenic
No off target data available for this crispr