ID: 938248472

View in Genome Browser
Species Human (GRCh38)
Location 2:129796504-129796526
Sequence TGGTTGTCACAGGGGCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938248461_938248472 11 Left 938248461 2:129796470-129796492 CCCTGGCCAGCTTCCCACTGCAG No data
Right 938248472 2:129796504-129796526 TGGTTGTCACAGGGGCAGCTGGG No data
938248460_938248472 26 Left 938248460 2:129796455-129796477 CCTTCTTGGGGGTGACCCTGGCC No data
Right 938248472 2:129796504-129796526 TGGTTGTCACAGGGGCAGCTGGG No data
938248463_938248472 5 Left 938248463 2:129796476-129796498 CCAGCTTCCCACTGCAGTGAAGG No data
Right 938248472 2:129796504-129796526 TGGTTGTCACAGGGGCAGCTGGG No data
938248462_938248472 10 Left 938248462 2:129796471-129796493 CCTGGCCAGCTTCCCACTGCAGT No data
Right 938248472 2:129796504-129796526 TGGTTGTCACAGGGGCAGCTGGG No data
938248465_938248472 -2 Left 938248465 2:129796483-129796505 CCCACTGCAGTGAAGGTCGATTG No data
Right 938248472 2:129796504-129796526 TGGTTGTCACAGGGGCAGCTGGG No data
938248466_938248472 -3 Left 938248466 2:129796484-129796506 CCACTGCAGTGAAGGTCGATTGG No data
Right 938248472 2:129796504-129796526 TGGTTGTCACAGGGGCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938248472 Original CRISPR TGGTTGTCACAGGGGCAGCT GGG Intergenic
No off target data available for this crispr