ID: 938248693

View in Genome Browser
Species Human (GRCh38)
Location 2:129797621-129797643
Sequence CTGGACATCCACCAGCACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938248693_938248707 26 Left 938248693 2:129797621-129797643 CCAAGGTGCTGGTGGATGTCCAG No data
Right 938248707 2:129797670-129797692 CAGCAGGGGCAGAAGTGGATAGG No data
938248693_938248706 21 Left 938248693 2:129797621-129797643 CCAAGGTGCTGGTGGATGTCCAG No data
Right 938248706 2:129797665-129797687 GGACACAGCAGGGGCAGAAGTGG No data
938248693_938248697 -4 Left 938248693 2:129797621-129797643 CCAAGGTGCTGGTGGATGTCCAG No data
Right 938248697 2:129797640-129797662 CCAGGGCCCAGCCAGAATTCAGG No data
938248693_938248708 27 Left 938248693 2:129797621-129797643 CCAAGGTGCTGGTGGATGTCCAG No data
Right 938248708 2:129797671-129797693 AGCAGGGGCAGAAGTGGATAGGG No data
938248693_938248704 11 Left 938248693 2:129797621-129797643 CCAAGGTGCTGGTGGATGTCCAG No data
Right 938248704 2:129797655-129797677 AATTCAGGAGGGACACAGCAGGG No data
938248693_938248705 12 Left 938248693 2:129797621-129797643 CCAAGGTGCTGGTGGATGTCCAG No data
Right 938248705 2:129797656-129797678 ATTCAGGAGGGACACAGCAGGGG No data
938248693_938248698 -1 Left 938248693 2:129797621-129797643 CCAAGGTGCTGGTGGATGTCCAG No data
Right 938248698 2:129797643-129797665 GGGCCCAGCCAGAATTCAGGAGG No data
938248693_938248699 0 Left 938248693 2:129797621-129797643 CCAAGGTGCTGGTGGATGTCCAG No data
Right 938248699 2:129797644-129797666 GGCCCAGCCAGAATTCAGGAGGG No data
938248693_938248703 10 Left 938248693 2:129797621-129797643 CCAAGGTGCTGGTGGATGTCCAG No data
Right 938248703 2:129797654-129797676 GAATTCAGGAGGGACACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938248693 Original CRISPR CTGGACATCCACCAGCACCT TGG (reversed) Intergenic
No off target data available for this crispr