ID: 938248696

View in Genome Browser
Species Human (GRCh38)
Location 2:129797640-129797662
Sequence CCTGAATTCTGGCTGGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938248696_938248707 7 Left 938248696 2:129797640-129797662 CCAGGGCCCAGCCAGAATTCAGG No data
Right 938248707 2:129797670-129797692 CAGCAGGGGCAGAAGTGGATAGG No data
938248696_938248703 -9 Left 938248696 2:129797640-129797662 CCAGGGCCCAGCCAGAATTCAGG No data
Right 938248703 2:129797654-129797676 GAATTCAGGAGGGACACAGCAGG No data
938248696_938248708 8 Left 938248696 2:129797640-129797662 CCAGGGCCCAGCCAGAATTCAGG No data
Right 938248708 2:129797671-129797693 AGCAGGGGCAGAAGTGGATAGGG No data
938248696_938248706 2 Left 938248696 2:129797640-129797662 CCAGGGCCCAGCCAGAATTCAGG No data
Right 938248706 2:129797665-129797687 GGACACAGCAGGGGCAGAAGTGG No data
938248696_938248711 30 Left 938248696 2:129797640-129797662 CCAGGGCCCAGCCAGAATTCAGG No data
Right 938248711 2:129797693-129797715 GCCACAGAGGCAGAGGATGATGG No data
938248696_938248705 -7 Left 938248696 2:129797640-129797662 CCAGGGCCCAGCCAGAATTCAGG No data
Right 938248705 2:129797656-129797678 ATTCAGGAGGGACACAGCAGGGG No data
938248696_938248710 23 Left 938248696 2:129797640-129797662 CCAGGGCCCAGCCAGAATTCAGG No data
Right 938248710 2:129797686-129797708 GGATAGGGCCACAGAGGCAGAGG No data
938248696_938248709 17 Left 938248696 2:129797640-129797662 CCAGGGCCCAGCCAGAATTCAGG No data
Right 938248709 2:129797680-129797702 AGAAGTGGATAGGGCCACAGAGG No data
938248696_938248704 -8 Left 938248696 2:129797640-129797662 CCAGGGCCCAGCCAGAATTCAGG No data
Right 938248704 2:129797655-129797677 AATTCAGGAGGGACACAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938248696 Original CRISPR CCTGAATTCTGGCTGGGCCC TGG (reversed) Intergenic