ID: 938248699

View in Genome Browser
Species Human (GRCh38)
Location 2:129797644-129797666
Sequence GGCCCAGCCAGAATTCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938248687_938248699 28 Left 938248687 2:129797593-129797615 CCAGGACCAGAGAGGGCTGGAGC No data
Right 938248699 2:129797644-129797666 GGCCCAGCCAGAATTCAGGAGGG No data
938248692_938248699 3 Left 938248692 2:129797618-129797640 CCACCAAGGTGCTGGTGGATGTC No data
Right 938248699 2:129797644-129797666 GGCCCAGCCAGAATTCAGGAGGG No data
938248693_938248699 0 Left 938248693 2:129797621-129797643 CCAAGGTGCTGGTGGATGTCCAG No data
Right 938248699 2:129797644-129797666 GGCCCAGCCAGAATTCAGGAGGG No data
938248688_938248699 22 Left 938248688 2:129797599-129797621 CCAGAGAGGGCTGGAGCTGCCAC No data
Right 938248699 2:129797644-129797666 GGCCCAGCCAGAATTCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938248699 Original CRISPR GGCCCAGCCAGAATTCAGGA GGG Intergenic