ID: 938248700

View in Genome Browser
Species Human (GRCh38)
Location 2:129797646-129797668
Sequence GTCCCTCCTGAATTCTGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938248700_938248710 17 Left 938248700 2:129797646-129797668 CCCAGCCAGAATTCAGGAGGGAC No data
Right 938248710 2:129797686-129797708 GGATAGGGCCACAGAGGCAGAGG No data
938248700_938248708 2 Left 938248700 2:129797646-129797668 CCCAGCCAGAATTCAGGAGGGAC No data
Right 938248708 2:129797671-129797693 AGCAGGGGCAGAAGTGGATAGGG No data
938248700_938248707 1 Left 938248700 2:129797646-129797668 CCCAGCCAGAATTCAGGAGGGAC No data
Right 938248707 2:129797670-129797692 CAGCAGGGGCAGAAGTGGATAGG No data
938248700_938248713 25 Left 938248700 2:129797646-129797668 CCCAGCCAGAATTCAGGAGGGAC No data
Right 938248713 2:129797694-129797716 CCACAGAGGCAGAGGATGATGGG No data
938248700_938248706 -4 Left 938248700 2:129797646-129797668 CCCAGCCAGAATTCAGGAGGGAC No data
Right 938248706 2:129797665-129797687 GGACACAGCAGGGGCAGAAGTGG No data
938248700_938248709 11 Left 938248700 2:129797646-129797668 CCCAGCCAGAATTCAGGAGGGAC No data
Right 938248709 2:129797680-129797702 AGAAGTGGATAGGGCCACAGAGG No data
938248700_938248711 24 Left 938248700 2:129797646-129797668 CCCAGCCAGAATTCAGGAGGGAC No data
Right 938248711 2:129797693-129797715 GCCACAGAGGCAGAGGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938248700 Original CRISPR GTCCCTCCTGAATTCTGGCT GGG (reversed) Intergenic
No off target data available for this crispr