ID: 938248702

View in Genome Browser
Species Human (GRCh38)
Location 2:129797651-129797673
Sequence GCTGTGTCCCTCCTGAATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938248702_938248714 28 Left 938248702 2:129797651-129797673 CCAGAATTCAGGAGGGACACAGC No data
Right 938248714 2:129797702-129797724 GCAGAGGATGATGGGTTCTGAGG No data
938248702_938248711 19 Left 938248702 2:129797651-129797673 CCAGAATTCAGGAGGGACACAGC No data
Right 938248711 2:129797693-129797715 GCCACAGAGGCAGAGGATGATGG No data
938248702_938248706 -9 Left 938248702 2:129797651-129797673 CCAGAATTCAGGAGGGACACAGC No data
Right 938248706 2:129797665-129797687 GGACACAGCAGGGGCAGAAGTGG No data
938248702_938248708 -3 Left 938248702 2:129797651-129797673 CCAGAATTCAGGAGGGACACAGC No data
Right 938248708 2:129797671-129797693 AGCAGGGGCAGAAGTGGATAGGG No data
938248702_938248707 -4 Left 938248702 2:129797651-129797673 CCAGAATTCAGGAGGGACACAGC No data
Right 938248707 2:129797670-129797692 CAGCAGGGGCAGAAGTGGATAGG No data
938248702_938248713 20 Left 938248702 2:129797651-129797673 CCAGAATTCAGGAGGGACACAGC No data
Right 938248713 2:129797694-129797716 CCACAGAGGCAGAGGATGATGGG No data
938248702_938248715 29 Left 938248702 2:129797651-129797673 CCAGAATTCAGGAGGGACACAGC No data
Right 938248715 2:129797703-129797725 CAGAGGATGATGGGTTCTGAGGG No data
938248702_938248709 6 Left 938248702 2:129797651-129797673 CCAGAATTCAGGAGGGACACAGC No data
Right 938248709 2:129797680-129797702 AGAAGTGGATAGGGCCACAGAGG No data
938248702_938248710 12 Left 938248702 2:129797651-129797673 CCAGAATTCAGGAGGGACACAGC No data
Right 938248710 2:129797686-129797708 GGATAGGGCCACAGAGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938248702 Original CRISPR GCTGTGTCCCTCCTGAATTC TGG (reversed) Intergenic
No off target data available for this crispr