ID: 938248703

View in Genome Browser
Species Human (GRCh38)
Location 2:129797654-129797676
Sequence GAATTCAGGAGGGACACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938248696_938248703 -9 Left 938248696 2:129797640-129797662 CCAGGGCCCAGCCAGAATTCAGG No data
Right 938248703 2:129797654-129797676 GAATTCAGGAGGGACACAGCAGG No data
938248692_938248703 13 Left 938248692 2:129797618-129797640 CCACCAAGGTGCTGGTGGATGTC No data
Right 938248703 2:129797654-129797676 GAATTCAGGAGGGACACAGCAGG No data
938248693_938248703 10 Left 938248693 2:129797621-129797643 CCAAGGTGCTGGTGGATGTCCAG No data
Right 938248703 2:129797654-129797676 GAATTCAGGAGGGACACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938248703 Original CRISPR GAATTCAGGAGGGACACAGC AGG Intergenic
No off target data available for this crispr