ID: 938248705

View in Genome Browser
Species Human (GRCh38)
Location 2:129797656-129797678
Sequence ATTCAGGAGGGACACAGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938248693_938248705 12 Left 938248693 2:129797621-129797643 CCAAGGTGCTGGTGGATGTCCAG No data
Right 938248705 2:129797656-129797678 ATTCAGGAGGGACACAGCAGGGG No data
938248696_938248705 -7 Left 938248696 2:129797640-129797662 CCAGGGCCCAGCCAGAATTCAGG No data
Right 938248705 2:129797656-129797678 ATTCAGGAGGGACACAGCAGGGG No data
938248692_938248705 15 Left 938248692 2:129797618-129797640 CCACCAAGGTGCTGGTGGATGTC No data
Right 938248705 2:129797656-129797678 ATTCAGGAGGGACACAGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938248705 Original CRISPR ATTCAGGAGGGACACAGCAG GGG Intergenic