ID: 938248707

View in Genome Browser
Species Human (GRCh38)
Location 2:129797670-129797692
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938248693_938248707 26 Left 938248693 2:129797621-129797643 CCAAGGTGCTGGTGGATGTCCAG No data
Right 938248707 2:129797670-129797692 CAGCAGGGGCAGAAGTGGATAGG No data
938248696_938248707 7 Left 938248696 2:129797640-129797662 CCAGGGCCCAGCCAGAATTCAGG No data
Right 938248707 2:129797670-129797692 CAGCAGGGGCAGAAGTGGATAGG No data
938248702_938248707 -4 Left 938248702 2:129797651-129797673 CCAGAATTCAGGAGGGACACAGC No data
Right 938248707 2:129797670-129797692 CAGCAGGGGCAGAAGTGGATAGG No data
938248700_938248707 1 Left 938248700 2:129797646-129797668 CCCAGCCAGAATTCAGGAGGGAC No data
Right 938248707 2:129797670-129797692 CAGCAGGGGCAGAAGTGGATAGG No data
938248692_938248707 29 Left 938248692 2:129797618-129797640 CCACCAAGGTGCTGGTGGATGTC No data
Right 938248707 2:129797670-129797692 CAGCAGGGGCAGAAGTGGATAGG No data
938248701_938248707 0 Left 938248701 2:129797647-129797669 CCAGCCAGAATTCAGGAGGGACA No data
Right 938248707 2:129797670-129797692 CAGCAGGGGCAGAAGTGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type